|
|
Registro Completo |
Biblioteca(s): |
Embrapa Unidades Centrais. |
Data corrente: |
02/05/2001 |
Data da última atualização: |
25/02/2019 |
Autoria: |
ANUNCIACAO, C. E.; ASTOLFI FILHO, S. |
Afiliação: |
CARLOS EDUARDO ANUNCIAÇÃO, Universidade Federal de Goiás - UFG/Departamento de Ciências Fisiológicas; SPARTACO ASTOLFI-FILHO, Universidade de Brasília - UnB/Departamento de Biologia Celular/Laboratório de Biologia Molecular. |
Título: |
Paternity test in "mangalarga-marchador" equines by DNA-fingerprinting. |
Ano de publicação: |
2000 |
Fonte/Imprenta: |
Pesquisa Agropecuária Brasileira, Brasília, DF, v. 35, n. 10, p. 2007-15, out. 2000. |
Idioma: |
Inglês |
Notas: |
Título em português: Teste de paternidade em eguinos Mangalarga-Marchador pela técnica do DNA 'fingerprinting". |
Conteúdo: |
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 105-fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively. |
Palavras-Chave: |
Clonagem molecular; Equine; Identification. |
Thesagro: |
Cavalo; Eqüino; Identificação; Método de Melhoramento; Polimorfismo Genético; Teste de Progênie. |
Thesaurus Nal: |
Breeding methods; Genetic polymorphism; Horses; Molecular cloning; Progeny testing. |
Categoria do assunto: |
-- |
URL: |
https://ainfo.cnptia.embrapa.br/digital/bitstream/AI-SEDE/18823/1/pab99_091.pdf
|
Marc: |
LEADER 01995naa a2200313 a 4500 001 1103540 005 2019-02-25 008 2000 bl uuuu u00u1 u #d 100 1 $aANUNCIACAO, C. E. 245 $aPaternity test in "mangalarga-marchador" equines by DNA-fingerprinting. 260 $c2000 500 $aTítulo em português: Teste de paternidade em eguinos Mangalarga-Marchador pela técnica do DNA 'fingerprinting". 520 $aGC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 105-fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively. 650 $aBreeding methods 650 $aGenetic polymorphism 650 $aHorses 650 $aMolecular cloning 650 $aProgeny testing 650 $aCavalo 650 $aEqüino 650 $aIdentificação 650 $aMétodo de Melhoramento 650 $aPolimorfismo Genético 650 $aTeste de Progênie 653 $aClonagem molecular 653 $aEquine 653 $aIdentification 700 1 $aASTOLFI FILHO, S. 773 $tPesquisa Agropecuária Brasileira, Brasília, DF$gv. 35, n. 10, p. 2007-15, out. 2000.
Download
Esconder MarcMostrar Marc Completo |
Registro original: |
Embrapa Unidades Centrais (AI-SEDE) |
|
Biblioteca |
ID |
Origem |
Tipo/Formato |
Classificação |
Cutter |
Registro |
Volume |
Status |
URL |
Voltar
|
|
Registros recuperados : 35 | |
5. | | PICANÇO, D. B.; SOUSA, N. R.; CLEMENT, C.; NAGAO, E. O.; ASTOLFI-FILHO, S. Discriminação de raças primitivas de pupunha (Bactris gasipaes) na Amazônia brasileira com marcadores moleculares (RAPDs). In: CONGRESSO NACIONAL DE GENÉTICA, 45., 1999, Gramado. Programa e resumos... Genetics and Molecular Biology, Ribeirão Preto, v. 2, n. 3, p. 290, Oct. 1999.Tipo: Resumo em Anais de Congresso |
Biblioteca(s): Embrapa Amazônia Ocidental. |
| |
8. | | SILVA, M. L. da; YUYAMA, K.; ALMEIDA, E. R. P. de; ASTOLFI-FILHO, S. Mecanismos de resistência ativos em frutos de camu-camu (Myrciaria dúbia (H.B.K.) Mc Vaugh). In: CONGRESSO NACIONAL DE BOTÂNICA, 57.; ENCONTRO ESTADUAL DE BOTÂNICOS, 13.; ENCONTRO ESTADUAL DE HERBÁRIOS, 5., 2006, Gramado, RS. [Anais...]. Porto Alegre, RS: Sociedade Botânica do Brasil, 2006. Não paginado.Tipo: Resumo em Anais de Congresso |
Biblioteca(s): Embrapa Recursos Genéticos e Biotecnologia. |
| |
11. | | ANGELO, P. C. da S.; ALMEIDA, E. R. P.; NUNES-SILVA, C. G.; ASSUNÇÃO, E. N.; ASTOLFI-FILHO, S. Primeira biblioteca de cDNA de frutos: etapa inicial para a análise do genoma funcional de guaranazeiro (Paullinia cupana var. sorbilis). In: ENCONTRO DE GENÉTICA DO AMAZONAS, 4.; ENCONTRO DE GENÉTICA DA REGIÃO NORTE, 1., 2003, Manaus. Livro de resumos. Manaus: SBG, 2003. p. 125.Tipo: Resumo em Anais de Congresso |
Biblioteca(s): Embrapa Amazônia Ocidental. |
| |
12. | | SOUSA, N. R.; CLEMENT, C. R.; RODRÍGUEZ, F. J. G.; PICANÇO, D. B.; MORENO, Y. N.; ASTOLFI-FILHO, S. Discriminação de raças primitivas de pupunha (Bactris gasipaes) na Amazônia brasileira com marcadores RAPDs & AFLPs. In: SIMPÓSIO DE RECURSOS GENÉTICOS PARA AMÉRICA LATINA E CARIBE - SIRGEALC, 2., 1999, Brasília. Anais... Brasília: Embrapa Recursos Genéticos e Biotecnologia, 1999. 1 CD-ROM.Tipo: Resumo em Anais de Congresso |
Biblioteca(s): Embrapa Amazônia Ocidental. |
| |
14. | | ANGELO, P. C. da S.; CIAMPI, A. Y.; SILVA, G. F.; PORTO, J. I. R.; ASTOLFI-FILHO, S.; ATROCH, A. L. Arquivo X: quimera gênica transcrita em planta do clado X da família Sapindaceae, o guaranazeiro. In: SIMPÓSIO INTERNACIONAL DE BOTÂNICA APLICADA, 2.; SIMPÓSIO NACIONAL DE FRUTÍFERAS E ORNAMENTAIS DO NORTE E NORDESTE, 2., 2013, Manaus. Anais... Manaus: Ufam, 2013.Tipo: Resumo em Anais de Congresso |
Biblioteca(s): Embrapa Amazônia Ocidental. |
| |
15. | | ANGELO, P. C. da S.; AMADO, M. V.; LIRA, M. do P. S.; ATROCH, A. L.; FARIAS, I. P.; ASTOLFI FILHO, S. Análise preliminar de marcadores microssatélite para guaranazeiro. In: SEMINÁRIO SOBRE PESQUISAS COM O GUARANAZEIRO NA AMAZÔNIA, 1., 2005, Manaus. Anais... Manaus: Embrapa Amazônia Ocidental, 2005. p. 159-167. 1 CD-ROM.Tipo: Artigo em Anais de Congresso |
Biblioteca(s): Embrapa Amazônia Ocidental. |
| |
17. | | ANGELO, P. C. da S.; CIAMPI, A. Y.; SILVA, G. F.; PORTO, J. I. R.; ASTOLFI-FILHO, S.; ATROCH, A. L. Microssatélites para distinguir cultivares clonais de guaranazeiro. In: SIMPÓSIO INTERNACIONAL DE BOTÂNICA APLICADA, 2.; SIMPÓSIO NACIONAL DE FRUTÍFERAS E ORNAMENTAIS DO NORTE E NORDESTE, 2., 2013, Manaus. Anais... Manaus: Ufam, 2013.Tipo: Resumo em Anais de Congresso |
Biblioteca(s): Embrapa Amazônia Ocidental. |
| |
18. | | MERIGUETE, I. L. de A. V.; ARAÚJO JÚNIOR, D. P. de; SEVALHO, E. de S.; MOURA, J. M. P.; ASTOLFI FILHO, S.; SILVA, C. G. N. da. Monitoramento na adoção de tecnologia agropecuária em Municípios-Hub no Estado do Amazonas. Revista GEINTEC, Aracaju, v. 10, n. 3, p. 5600-5613, jul./ago./set. 2020. Título em Inglês: Monitoring adoption of agricultural technology in Municipalities-Hub in the State of Amazonas.Biblioteca(s): Embrapa Amazônia Ocidental. |
| |
19. | | ANGELO, P. C. da S.; CIAMPI, A. Y.; SILVA, G. F.; PORTO, J. I. R.; ASTOLFI-FILHO, S.; ATROCH, A. L. Dinucleotide blocks with eight repeats are few in the huge genome of the guarana plant. In: SIMPÓSIO INTERNACIONAL DE BOTÂNICA APLICADA, 2.; SIMPÓSIO NACIONAL DE FRUTÍFERAS E ORNAMENTAIS DO NORTE E NORDESTE, 2., 2013, Manaus. Anais... Manaus: Ufam, 2013.Tipo: Resumo em Anais de Congresso |
Biblioteca(s): Embrapa Amazônia Ocidental. |
| |
20. | | CARVALHO, N. D. M.; SOARES, S. K. B.; ASSUNÇÃO, E. N.; ANGELO, P. C. S.; ASTOLFI-FILHO, S.; ATROCH, A. L. Dinucleotide repeats in guarana fruits and SEEDS ESTs. In: CONGRESSO BRASILEIRO DE GENÉTICA, 52., 2006, Foz do Iguaçu, PR. Resumos... Ribeirão Preto, SP: Sociedade Brasileira de Genética, 2006. p. 103.Tipo: Resumo em Anais de Congresso |
Biblioteca(s): Embrapa Amazônia Ocidental. |
| |
Registros recuperados : 35 | |
|
Nenhum registro encontrado para a expressão de busca informada. |
|
|